I think the following merge should be unambiguous. Read 1 is a 69 base-pair sequence with the first barcode from the first set prepended. Read 2 is a reverse complement of the 69 base-pair sequence with the first barcode from the second set prepended.
@NS500217:348:HTW2FBGXY:1:11101:22352:1064 1:N:0:0
TGACGCACTAGCATTACTTATATGATATGTCTCCATACCAATTACAATCTCCAAGTGAACGAGATCGGAAGAGCAC
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
@NS500217:348:HTW2FBGXY:1:11101:22352:1064 2:N:0:0
GTCTCAAGTGCTCTTCCGATCTCGTTCACTTGGAGATTGTAATTGGTATGGAGACATATCATATAAGTAATGCTAG
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
Barcodes are:
TGACGCA:ATCGTGC:CAGTATG:GCTACAT
GTCTCAA:TAGAGCC:ACTCTGG:CGAGATT
I think the problem is the same merge is counted in both the forward and reverse analysis steps.
I think the following merge should be unambiguous. Read 1 is a 69 base-pair sequence with the first barcode from the first set prepended. Read 2 is a reverse complement of the 69 base-pair sequence with the first barcode from the second set prepended.
Barcodes are:
I think the problem is the same merge is counted in both the forward and reverse analysis steps.