This is a general pipeline for analysis of small RNA (sRNA) sequencing data from Illumina. It has mainly been developed with focus on the Arabidopsis TAIR10 genome and some related species, but it should be fully functional with other organisms. The scripts do not require to pass command-line arguments; settings like input data and reference genomic files have to be specified by editing the script in a text editor. Therefore, some very basic knowledge of linux and R is required. The scripts are generously commented in hashes (#) with complementary suggestions and hints (worth to read as a complement to this instruction). It produces basic background output for customised downstream analysis.
Linux, Mac OS
Shell scripts (*.sh) of this software were developed and tested using GNU bash (v4.4.20) in a Ubuntu 18.04 linux system. R scripts were developed using the R console (v4.1.1) in macOS Monterey.
The following tools need to be installed and ideally available in the PATH environment. The pipeline is fully functional and tested with the following versions of the packages listed below. Other versions are very likely functional as well, but a detailed compatibility review of older and newer versions has not been done here.
fastqc (v0.11.9)
cutadapt (v4.1 with Python 3.8.5)
bowtie (v1.3.1)
ShortStack (v3.8.5)
bedtools (v2.26.0)
samtools (v1.3.1)
The raw data (Illumina single-end fastq files) should be allocated in sample folders under a parent directory (/REPLICATES_TOTAL) following the file structure below. Single replicates are the basic units of this pipeline. Merging of replicates within conditions is usually considered after a first evaluation of the results, the merging itself can be performed at different stages (from raw sequences to fully processed files) depending on data structure, experimental design and taste. It is not handled here. Intermediary and final output files will be generated in respective sample folders. In the following example four samples are used: two conditions (mutant and wt) with two replicates each (rep1 and rep2).
├── REPLICATES_TOTAL
└── mutant_rep1
│ └── mutant_Rep1_FKDL210177288-1a-3_H3TM7DSX2_L4_1.fq.gz
└── mutant_rep2
│ └── mutant_Rep2_FKDL210177288-1a-4_H3TM7DSX2_L4_1.fq.gz
└── wt_rep1
│ └── Col_Rep1_FKDL210177288-1a-1_H3TM7DSX2_L4_1.fq.gz
└── wt_rep2
└── Col_Rep2_FKDL210177288-1a-2_H3TM7DSX2_L4_1.fq.gz
The paths to the working and sample directories, and reference genomic files have to be specified by editing the header of the respective shell script (*.sh).
##################################################################################
########### Reference files to be used and working dir ###################
##################################################################################
#genomic assembly in fasta format
genome_assembly_fasta="/home/jsantos/genome_ref/TAIR10/bowtie1/TAIR10_chr_all.fasta"
#genomic chromosome sizes txt file
genome_chr_sizes="/home/jsantos/genome_ref/TAIR10/TAIR10.chrom.sizes"
#bowtie1 indexes to be used
genome_non_sRNA_bw_idx="/home/jsantos/genome_ref/TAIR10/sRNA_filter/non_sRNA"
genome_bw_idx="/home/jsantos/genome_ref/TAIR10/bowtie1/TAIR10"
#annotation files in bed format
genes_annot_bed="/home/jsantos/genome_ref/TAIR10/bed_landscape/TAIR10_genes_isoform1_annot.bed"
tes_annot_bed="/home/jsantos/genome_ref/TAIR10/bed_landscape/TAIR_transposable_elements_6col.bed"
##################################################################################
#working directory where all the sample directories are allocated
working_dir="/media/diskb/nicolas_tmp/REPLICATES_TOTAL"
#this defines the samples to be analysed (dir names)
sample_list="mutant_rep1 mutant_rep2 wt_rep1 wt_rep2";
If removing structural RNAs is wanted before downstream processing, a fasta file with the selected structural RNAs (including e.g. pre-tRNA, snoRNA, snRNA, rRNA) has to be prepared (with e.g. bedtools getfasta) and bowtie-indexed accordingly. Otherwise the pipeline can easily be modified skipping this step.
Annotation files (gtf or gff3) have to be transformed to a 6-column bed format looking like in the one below (TAIR10_genes_isoform1_annot.bed).
Chr1 3631 5899 AT1G01010 . +
Chr1 5928 8737 AT1G01020 . -
Chr1 11649 13714 AT1G01030 . -
Chr1 23146 31227 AT1G01040 . +
Chr1 28500 28706 AT1G01046 . +
Two annotation bed files, one for genes and one for transposable elements (TE), are to be used here. To prepare bed files out of gtf or gff3 files is not straightforward. The gff2bed tool from BEDOPS suit is an option. Another possibility, often more pragmatic, is to process it with a combination of linux regular expressions and/or manual editing in a text editor.
Chromosome sizes should also be specified in a reference file (TAIR10.chrom.sizes) in the followin way.
Chr1 30427671
Chr2 19698289
Chr3 23459830
Chr4 18585056
Chr5 26975502
Annotation files in bed format, a fasta file with structural RNAs, and a text chromosome size file for the TAIR10 Arabidopsis genome are provided under example.
Ordinary assembly fasta files and bowtie indexed fasta files (bowtie-build) should be available for the relevant genome and are usually downloadable from general or organism-specific genome repositories like (TAIR10).
Shell scripts can be cloned and run directly on a linux server.
git clone https://github.com/Ingefast/small_RNA_analyser.git
cd small_RNA_analyser
Read quality (fastqc) is assessed before and after adapter trimming (cutadapt). Additionaly a size range trimming is performed, e.g. selecting a typical population of reads between 18 and 30 nt long.
Usage:
nohup bash sRNA.QC_Trimmer.sh
A final file with trimmed sequences in raw text format is generated (sample.trimmed.txt).
Trimmed sequences belonging to structural RNAs and 'authentic' sRNA reads are segregated by mapping (bowtie) the reads to a fasta file with structural RNAs. Unmapped reads are considered for downstream analysis and, after a second mapping, only those aligning with zero mismatches to the genome are kept (sample.perfect.txt).
Usage:
nohup bash sRNA.Filter.sh
In addition a table containing unique sequence signatures, their abundance and length is generated (sample.perfect.pivot.table.txt).
TCCGCTGTAGCACACAGGC 173995 19
GCGGACTGCTCGAGCTGC 136325 18
TCCGCTGTAGCACTTCAGGC 112283 20
CAGCGGACTGCTCGAGCTGC 103107 20
TCCGCTGTAGCACTTCAGGCT 51141 21
Once the desired population of sRNA reads have been filtered, further processing can be done focusing on customised sRNA sizes. Apart of the whole range of sRNA reads define here (18-30nt), other usual choices are the 21-22 nt and 24 nt categories. The latter can be taylored in the sRNA.Mapper.range_1830nt.sh script by replacing the text string 'size_1830nt' to e.g. and 'size_2122nt' and changing the cutadapt size trimming settings as:
cutadapt --no-trim -m 21 -M 22 -o sample.size_sel.fastq ../sample.perfect.fastq > summary_NOtrimming.txt;
At this step time reads are mapped using ShortStack which is a wrapper of bowtie designed to handle multimapping reads.
Usage:
nohup bash sRNA.Mapper.range_1830nt.sh
Important output files are the following:
- A table of genomic features and their expression values in Read Per Million (RPM).
genomic_RPM_values.genes.txt, genomic_RPM_values.tes.txt
Chr1 23146 31227 AT1G01040 . + 1.245824286
Chr1 28500 28706 AT1G01046 . + 0
Chr1 31170 33153 AT1G01050 . - 0.5813833333
Chr1 33666 37840 AT1G01060 . - 0.7474928571
- Similar tables but with raw count values.
gene.counts.txt, te.counts.txt
Combining the two kind of tables across sample above one can easily build a general table for the whole experiment like total_table.size_24.genes.txt in the output folder. Minimal formatting of this table allows for differential expression analysis in e.g. DESeq2.
- Table with sRNA read mapping coordinates, unique read identity number (fourth column), and feature affected.
gene.reads.txt, te.reads.txt
Chr1 16990 17013 776187 Chr1 16882 17009 AT1TE00020
Chr1 17004 17027 84575 Chr1 16882 17009 AT1TE00020
Chr1 17004 17027 84578 Chr1 17023 18924 AT1TE00025
Chr1 17856 17874 178759 Chr1 17023 18924 AT1TE00025
- Table with a unique read identity number and their sequence linking to the tables above.
srna_ids.txt
520486 GATTCAAGACTTCTCGGTACT
84989 GTACTGCAAAGTTCTTCCGCC
155073 ACTGCAAAGTTCTTCCGCCTGAT
231101 ACTGCAAAGTTCTTCCGCCT
- A browsable bedGraph file sample.bedGraph (see Figure 1A).
The processed data provided so far opens a wide range of analytical possibilities such as studying the relationship between sRNA expression and occurrence of diverse epigenetic marks and/or expression and silencing of genes,transposable elements.
Two common basic analyses are presented here as examples.
1. Checking data structure and replicability in the data set. Multivariate analysis and correlogram.
With sRNA.correlogram_plotter.r it is possible to analyse the table total_table.size_24.genes.txt to plot the correlation between particular sRNA expression values across all the samples. This is a good way to check for deviant samples and assess replicability. A scatterplot in the lower diagonal panel is presented and Pearson correlation coefficients in the upper panel (Figure 2B). The script sRNA.ordination_analyser.r performs a multivariate analysis using the same input table to evaluate the similarities between samples. By default the samples are ordinated with Nonmetric multidimensional scaling (NMDS) as implemented in the R library vegan (Figure 2C). Principal component analysis (PCA) and redundancy analysis (RDA) are also available as alternative ordination approaches.
Figure 1. (A) bedGraph files of a wildtype in Capsella for different sRNA sizes. (B) Correlogram of 24nt sRNA values over genes in three conditions with two replicates each. (C) NMDS diagram of the same dataset.
Understanding the relative importance of sRNA of particular sizes on the expression of genes and TEs is central for any sRNA study. The script sRNA.size_distribution_plotter.r plots the abundance (RPM) of sRNA reads of different sizes over selected genomic features (genes and TEs). Inputs are the previously generated gene.reads.txt and te.reads.txt files. Additionally, a file with total number of mapped reads for each sample has to be created manually (read_n_baseline.txt) in order to establish a baseline for normalisation,
sample_name mapped
mutantA_rep1 646980
mutantA_rep2 991033
mutantB_rep1 491573
mutantB_rep2 546385
wt_rep1 390199
wt_rep2 999514
The number of mapped reads can be estimated with e.g.
wc -l sample.perfect.txt
Figure 2. sRNA size distribution over genes and transposable elements in Arabidopsis.
Modified versions of this pipeline have been used to process the sRNA datasets in the following papers:
-
Martinez G et al (2018). Paternal easiRNAs regulate parental genome dosage in Arabidopsis. Nature Genetics 50 (2) 193-198.
-
Wang Z et al (2020). Polymerase IV Plays a Crucial Role in Pollen Development in Capsella. Plant Cell 32 (4) 950-966.
juan.santos at slu.se


