Skip to content

RNAcentral/r2dt-web

Repository files navigation

R2DT-Web

This is an embeddable component that you can include in your website to visualise RNA secondary structures.

How to use

Only two lines of code are needed to use this widget: one line with the r2dt-web tag and another with the script for this component, for example:

<r2dt-web/>
<script type="text/javascript" src="/path/to/r2dt-web.js"></script>

And then the component provides a simple input box where you can paste an RNA/DNA sequence, URL or job ID. Search input

To use the latest stable version without worrying about updates, use the component's JavaScript package available at GitHub:

<script type="text/javascript" src="https://rnacentral.github.io/r2dt-web/dist/r2dt-web.js"></script>

If you prefer to install this package and perform the updates manually, see the Installation section.

Other methods of use

If you already have an external URL that returns an SVG generated by R2DT, you can provide it through the search attribute as a JSON object.

<r2dt-web search='{"url": "https://example.com/svg"}'></r2dt-web>

To load an RNAcentral identifier (URS), pass it in the same way:

<r2dt-web search='{"urs": "URS0000049E57"}'></r2dt-web>

URS visualisation

Click here to see how you can find an RNAcentral identifier for an RNA sequence.

If neither url nor urs is provided, the component will display a search field. You can optionally display example sequences using the examples attribute.

<r2dt-web 
    examples='[
        {"description": "RNA5S1-8", "sequence": "GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU"},
        {"description": "TRT-TGT2-1", "sequence": "GGCTCCATAGCTCAGTGGTTAGAGCACTGGTCTTGTAAACCAGGGGTCGCGAGTTCGATCCTCGCTGGGGCCT"}
    ]'
/>

Search with examples

Installation

Clone this repository from GitHub.

git clone https://github.com/RNAcentral/r2dt-web.git

Now you can add the component's JavaScript bundle (it contains all the styles and fonts) to your web page either directly or through an import with Webpack:

<script type="text/javascript" src="/r2dt-web/dist/r2dt-web.js"></script>

Attributes/parameters

This component accepts a number of attributes. You pass them as html attributes and their values are strings (this is a requirement of Web Components):

parameter description
search JSON object with url or urs attributes
examples Array of example sequences with description and sequence
legend Legend position (left by default). Can be left, right and center

Local development

  1. npm install

  2. npm run update-templates to use the latest models from the R2DT repository

  3. npm start to start a server on http://localhost:9000/

  4. npm run build to generate a new distribution

  5. npm test to run unit tests

Notes

  • Implemented as a Web Component using pure JavaScript — no React or Redux dependencies.
  • If both url and urs are provided, urs takes precedence.

About

Web component for visualising RNA secondary structure in standard orientations

Resources

License

Stars

5 stars

Watchers

3 watching

Forks

Packages

 
 
 

Contributors