Skip to content

qingxiangguo/Tools-for-Cancer-Genome-Analysis

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

239 Commits
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Tools-and-tricks-for-Cancer-Genome-Analysis

Installation and usage for various tools for cancer genomics

Contributors

Qingxiang (Allen) Guo
Postdoctoral Fellow
Northwestern University, Feinberg School of Medicine qingxiang.guo@northwestern.edu

Introduction

A collection of installation and usage guides, focusing on cancer genomics tools. Written by someone who survived one too many 'comprehensive' manuals and lived to tell a simpler tale.

Tools

Data transfer

Configuration and management

DNA and RNA-seq aligner (splice aware)

Splice unware aligner

RNA-seq aligner (splice aware)

Manipulating and analyzing alignments

Indel calling

Genome structural variation detection (NGS)

Genome structural variation detection (long read)

Genome structural variation VCF manipulation and downstream analysis

Genome structural variation simulation

Gene fusion analysis - RNA-seq level

Nanopore ONT analysis

Dealing with FastQ/FASTA

modification analysis

Other small tricks and tips

Find and load R in Northwestern quest

You can see which versions of R are available on Quest, and which version is the default, with the command

module spider R

You can make a particular version of R available to use by typing the full module name with the version included as listed in the output

module load R/4.2.0

Batch download SRA files from NCBI

Go to the NCBI SRA site, select the SRA file you need and go to "Run selector" to got batch list in this way.

Use perl one-liner to process the header

perl -p -i -e 's/(\S+)\n/"$1", /g' list

Revise the script and batch download with the python script:

# _*_ coding=utf-8 _*_
import subprocess

# Insert your SRR accession numbers here
sra_accession_number = ["SRR11951439", "SRR11951443", "SRR11951444", "SRR11951445", "SRR11951446", "SRR11951447", "SRR11951448",
                        "SRR11951449", "SRR11951450", "SRR11951451", "SRR11951452", "SRR11951453", "SRR11951454", "SRR11951455",
                        "SRR11951456", "SRR11951457", "SRR11951458", "SRR11951459", "SRR11951460", "SRR11951461", "SRR11951462",
                        "SRR11951463", "SRR11951464", "SRR11951465", "SRR11951466", "SRR11951467", "SRR11951468", "SRR11951469",
                        "SRR11951470", "SRR11951471", "SRR11951472", "SRR11951473", "SRR11951474", "SRR11951475", "SRR11951476",
                        "SRR11951477", "SRR11951478", "SRR11951479", "SRR11951480", "SRR11951481", "SRR11951482", "SRR11951483",
                        "SRR11951484", "SRR11951485", "SRR11951486", "SRR11951487", "SRR11951488", "SRR11951489", "SRR11951490",
                        "SRR11951491", "SRR11951492", "SRR11951493", "SRR11951494", "SRR11951495", "SRR11951496", "SRR11951497",
                        "SRR11951498", "SRR11951499", "SRR11951500", "SRR11951501", "SRR11951502", "SRR11951503", "SRR11951504",
                        "SRR11951505", "SRR11951506", "SRR11951507", "SRR11951508", "SRR11951509", "SRR11951510", "SRR11951511",
                        "SRR11951512", "SRR11951513", "SRR11951514", "SRR11951515", "SRR11951516", "SRR11951517", "SRR11951519",
                        "SRR11951520", "SRR11951521", "SRR11951522", "SRR11951523", "SRR11951524", "SRR11951525", "SRR11951526",
                        "SRR11951527", "SRR11951528", "SRR11951530", "SRR11951531", "SRR11951532", "SRR11951533", "SRR11951534",
                        "SRR11951535", "SRR11951536", "SRR11951537", "SRR11951542"]

# This will download the .sra files to ~/ncbi/public/sra/ (will create directory if not present)
for sra_id in sra_accession_number:
    print("Current downloading" + sra_id)
    prefetch_cmd = "prefetch " + sra_id + " -O /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT" # Note the space between commands
    print("The running command is " + prefetch_cmd)
    subprocess.call(prefetch_cmd, shell=True)

# This will create the fastq file from the downloaded sra file
for sra_id in sra_accession_number:
    print("Creating fastq file for" + sra_id)
    fasterq_dump_cmd = "fasterq-dump /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT/" + sra_id + " -O /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT/" + sra_id # Use the fstring here
    print("The running command is " + fasterq_dump_cmd)
    subprocess.call(fasterq_dump_cmd, shell=True)

Batch remove a certain type of files from a directory

python batch_delete_all_sra_files.py

Use Mamba or Conda environment in Slurm Batch sbumit in NU Quest

You have to resource the mamba by yourself

#!/bin/bash
#SBATCH --account=b1042
#SBATCH --partition=genomics ## Required: (buyin, short, normal, long, gengpu, genhimem, etc)
#SBATCH --time=03:00:00 ## Required: How long will the job need to run (remember different partitions have restrictions on this parameter)
#SBATCH --nodes=1 ## how many computers/nodes do you need (no default)
#SBATCH --ntasks-per-node=6 ## how many cpus or processors do you need on per computer/node (default value 1)
#SBATCH --mem=35G ## how much RAM do you need per computer/node (this affects your FairShare score so be careful to not ask for more than you need))
#SBATCH --job-name=allen_download ## When you run squeue -u  this is how you can identify the job
#SBATCH --output=output.log ## standard out and standard error goes to this file

# A regular comment in Bash
/home/qgn1237/2_software/mambaforge/bin/mamba init

source ~/.bashrc

mamba activate mamba666

minimap2 -d /home/qgn1237/qgn1237/1_my_database/GRCh38_p13/minimap2_index/GRCh38.p13.genome.mmi /projects/b1171/qgn1237/1_my_database/GRCh38_p13/GRCh38.p13.genome.fa -t 6

Batch create directories from list

python ./batch_create_directory_from_list.py

Cancel a job in NU Quest

scancel -u NETID

Kill a job

scancel 35087 

Solve the error when connecting quest using SSH client: client_global_hostkeys_private_confirm: server gave bad signature for RSA key 0

This might because the cliend delete your key file, and the server can't recognize you. Run the cmd to regenerate the keys:

/usr/bin/ssh-keygen -A

Estimate genome coverage from sorted BAM file to exclude files with too low genome coverage

estimate_bam_genome_coverage.py

It will produce a coverage_list, exclude single cells that less than 10% coverage, and get a bad list

second_coloumn_smaller_than.py

Calculate the genome depth (total mapped length/total genome base)

calculate_genome_depth_fast.py <your BAM file>

How to remain connect with SSH on MAC

sudo vim /etc/ssh/sshd_config

Then edit the content: #ClientAliveInterval 900 #ClientAliveCountMax 10

sudo launchctl start com.openssh.sshd

Make a alias for your command

alias sq='squeue | grep "netid"'

alias cdd='cd ../../'

alias ma='mamba activate mamba666'

alias rl='readlink -f'

alias sb='sbatch'

alias lsn='less -SN'

alias vim='lvim'

alias ls='lsd'

Add these lines to ~/.bash.rc then source

Upload seq data directly from Nanopore to NU Quest server

You can treat Nanopore MinION as a server itself. First, login into MinION with wifi, and get the IP address of MinION. Then, at your on PC terminal, type: ssh -x minit@. The it will ask you for the password. The password is: minit. Then you will login into MinION system.

Navigate the system, cd .. to the higher level of directory and find your data.

Then use the following command to transfer

rsync -avz /path/to/minion/files qgn1237@quest.northwestern.edu:/home/qgn1237

You can add --append-verify if you want to resume.

# Then it will ask you for the password of northwestern Quest

Use bash to loop make new directory in current directory

for dir in */; do cd "$dir"; mkdir 10X_depth ; cd ..; done

Generate sbatch cmd list by specifying the input file and the suffix you want, this can sava time and avoid mistake

# Edit the cmd = f"samtools view -s 0.384 -b {input_file_abs_path} -@ 8 > {input_file_base_name}.{suffix}" in generate_cmd.py to your desired command
./generate_cmd.py ../VCaP.bam 10X.bam 

# Then excute in the directory where you want to store the ouput file
sbatch cmd_list

# You can customize the command as you like

./pbsv2_cmd.py 22Rv1_10X_sort.svsig.gz var.vcf

Add the PATH environment variable

echo 'PATH=$PATH:/home/qgn1237/1_script' >> ~/.bashrc
source ~/.bashrc

Find the files end with certain suffix in current direcotry

find_suffix_in_current_directory.py <suffix>

Filter vcf based on quality

filter_vcf_based_on_quality.py input.vcf 20 > output.vcf

Install and import Dracula theme (my favorite theme) into Iterm2, Chrome Vimium, Chrome

For Iterm2 go to any folder and run command:

git clone https://github.com/dracula/iterm.git

cd iterm/  # Then go to the profiles panel of Iterm2, select your profiles, --> . colors, and import the  Dracula.itermcolors file, 

# Then select Dracula in color presets done!

For Vimium,go into the Vimium addon's preferences, right-click the Vimium icon next to the address bar and select “Manage Extension.” On the Extensions page, paste https://raw.githubusercontent.com/dracula/vimium/master/vimium-dracula.css to CSS for Vimium UI

For Chrome, install in https://chrome.google.com/webstore/detail/dracula-chrome-theme/gfapcejdoghpoidkfodoiiffaaibpaem

Copy all the file including hidden files

cp -r ~/OneDrive\ -\ Northwestern\ University/deep_learning_math_theory/. ./

Use Python script to fulfill the function of Bash "for $dir in ./; do ..."

bash_cmd_to_python.py

How to configure the local SSH and key to enable rapid login

first edit the file: ~/.ssh/config Add content:

Host quest
    HostName quest.northwestern.edu
    User XXX
    Port 22

create a SSH key and copy to server

ssh-keygen
# you will be prompted to enter a passphrase for the key, enter for no password. This is a password for password. Don't use it.

ssh-copy-id quest
# copy your public key to an existing server, it will prompt you for the password of the remote user’s account
# Type in the password (your typing will not be displayed for security purposes) and press ENTER. 
# The utility will connect to the account on the remote host using the password you provided. It will then copy the contents of your 
# ~/.ssh/id_rsa.pub key into a file in the remote account’s home ~/.ssh directory called authorized_keys.

# You should be able to log into the remote host without the remote account’s password
ssh quest

Download from quest to local and upload from local to quest

rsync -azvhP quest:~/R/ ./local

rsync -azvhP ./Tools-for-Cancer-Genome-Analysis/scripts/plot_VCF_chrom_freq_count.py quest:~/1_script/

Install NeoVim from source code

You need to install new gcc, cmake, and make

git clone https://github.com/neovim/neovim

cd neovim

mamba install -c conda-forge cmake # Install cmake

make CMAKE_INSTALL_PREFIX=/home/qgn1237/2_software/mambaforge/envs/mamba666/ # Avoid root

make install

# add alias
alias vim='nvim'

Install NeoVim by brew

brew install neovim

Find a file by name

find ./ -name "my_software_overlapp*"

Double loop in bash, this can make you more efficient

for i in 22Rv1 DU145 LNCaP PC3 VCaP; do cd $i; for j in ./*depth; do rl $j/delly/*_filtered.vcf > $j/SURVIVOR/list_vcf; rl $j/manta/results/variants/tumorSV.vcf >> $j/SURVIVOR/list_vcf; done; cd ..; done

Install Cargo (Rust)

curl https://sh.rustup.rs -sSf | sh
# Type 1 and enter
fish_add_path /Users/qgn1237/.cargo/bin

You can use cargo now.

Usage of Rust Cargo to install rm-improved, which will give you a trash can for deletion

cargo install rm-improved
# Then you will have 'rip' command
mkdir trash_can
# Remove file
rip t.p 
# Undo the last deletion
rip -u
# Change the graveyard 
export GRAVEYARD=/home/qgn1237/qgn1237/trash_can
# You can also udo specific files
rip -u 

Error: AttributeError: module 'matplotlib' has no attribute 'use'"

# Uninstall and install matplotlib again
pip uninstall matplotlib
pip install matplotlib

Useful Rust command collection, lsd command, dust command in Rust

The next gen ls command, a more intuitive version of du in rust

cargo install lsd
cargo install du-dust
# You can then alias the lsd to ls

Useful Rust command collection, fd-find

cargo install fd-find

You can use it like,

fd vcf  # part of the file name
fd -e vcf # Specific extension

Useful Rust command collection, exa, to check files by tree

cargo install fd-find

You can use it like,

exa -T

Soft link your file to Onedrive in Windows

mklink /D "OneDrive path/file_name" "/local/file_name"

Then the file will be automatically updated.

Install Starship prompt in your linux system or mac local system

Starship is the minimal, blazing-fast, and infinitely customizable prompt for any shell! Let's install in quest first.

curl -O https://starship.rs/install.sh
chmod 755 install.sh
# Install to your own directory
./install.sh -b ~/.local/bin

# If you use bash shell, add the following to the end of ~/.bashrc:
# Before conda init block!
eval "$(starship init bash)"
source ~/.bashrc

# If you use mac Fish, add the following in the center  ~/.config/fish/config.fish:
starship init fish | source 

# Exit and you're done!

Make use of ~/.local/bin

Try to make a bin file if there is not. The /home/qgn1237/.local/bin will by default in your $PATH. So try to link or move the binary file of your different mamba/conda ENV in this directory, so you don't need to shift between ENV now.

For example

[qgn1237@quser23 ~]$ which vim
alias vim='nvim'
 ~/.local/bin/nvim

Install Fish on MAC and switch from Bash to Fish as default shell

First make sure you have installed Homebrew.

brew install fish
# Make sure that you've successfully installed Fish
fish --version
# Make Fish as your default shell
# Add /usr/local/bin/fish to your list of shells

# It should be noted that, for the M2 chip mac, homebrew will not install stuff
# in /usr/local/bin/fish , but /opt/homebrew/bin/fish

# Besides, the following command will not work 
sudo echo /usr/local/bin/fish >> /etc/shells
Changing shell for qgn1237.
Password for qgn1237:
chsh: /usr/local/bin/fish: non-standard shell

# This is because, the latter doesn't work because the 
# output redirection >> is (tried to be) applied by the shell 
# before the sudo … is executed, and of course the user shell 
# has no permission to do that.

Instead, you should do:

echo /opt/homebrew/bin/fish | sudo tee -a /etc/shells
chsh -s /opt/homebrew/bin/fish

Exit and restart your shell, you'are done.

# Fish can do many little tricks
# Calculation
math 2/5
0.4

Install Fish shell on a remote cluster that you can not sudo

I've rarely explore the other possibility besides bash, and I don't think comfort zone is a good sign for me. So I decide to switch to Fish, which seems to be more powerful.

# You can refer to https://yangyangli.top/posts/012-make-a-powerful-ternimal/
# Know your current shell
echo $SHELL
# Go to mamba environment
ma
# Build from source code
wget https://github.com/fish-shell/fish-shell/archive/refs/tags/3.6.0.tar.gz
tar zxf 3.6.0.tar.gz
cd fish-shell-3.6.0/
mkdir build
cd build
cmake -DCMAKE_INSTALL_PREFIX=$HOME/.local ..
# This would install fish and its associated files under $HOME/.local. The fish executable would be located in $HOME/.ocal/bin (which you may want to add to your $PATH).
make
make install

When you type: fish, it shows: fish: error while loading shared libraries: libpcre2-32.so.0: cannot open shared object file: No such file or director

This because fish can not find the lib file, and you also don't have the permission to /usr/local/lib. The solution is to find the path of libpcre2-32.so.0

❯ find_suffix_in_current_directory.py libpcre2-32.so.0
./2_software/mambaforge/pkgs/pcre2-10.40-hc3806b6_0/lib/libpcre2-32.so.0
./2_software/mambaforge/envs/mamba_py_39/lib/libpcre2-32.so.0
./2_software/mambaforge/envs/mamba666/lib/libpcre2-32.so.0

echo 'export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:~/2_software/mambaforge/pkgs/pcre2-10.40-hc3806b6_0/lib/' >> ~/.bashrc
source ~/.bashrc

# Type fish and you're good!
# Now make it as your default shell
vim ~/.config/fish/config.fish
# add 
starship init fish | source
# When you go to fish, the starship will prompt automatically.

Next step, let's make you to change to Fish automatically while connect to server. chsh won't do it without the shell being listed in /etc/shells, and other ways of editing that configuration also require root permissions.

# Add this to .bashrc
if [[ $- = *i* ]]; then
   exec fish
fi

Now you're all good, everytime you login into bash, bashrc will lead you to fish Then fish will start starship automatically.

The fish version can not be shown, the git version may be too old

# Upgrade your git command first
mamba install -c anaconda git
# Uninstall fish
rip /home/qgn1237/.local/etc/fish/
rip /home/qgn1237/.local/share/fish
rip /home/qgn1237/.config/fish
cd /home/qgn1237/.local/bin
rip fish fish_indent fish_key_reader

# Reinstall fish
git clone https://github.com/fish-shell/fish-shell.git
cd fish-shell/
cmake -DCMAKE_INSTALL_PREFIX=$HOME/.local .
make
make install

fish --version
# fish, version 3.6.0-24-g16369a3ab

# You're good now. The problem is because that the git is too old.
# Fish generates the version at build time with the build_tools/git_version_gen.sh script

Permantly add alias (functions) to fish

alias -s sq='squeue | grep "qgn1237"'

alias -s cdd='cd ../../'

alias -s ma='mamba activate mamba666'

alias -s rl='readlink -f'

alias -s sb='sbatch'

alias -s lsn='less -SN'

alias -s vim='lvim'

alias -s ls='lsd'

alias -s zcp='zellij action close-pane'

# That creates ~/.config/fish/functions/ls.fish which will then be available in any fish session.

Or you can edit the fish rc file

vim ~/.config/fish/config.fish
# Add all the alis to thr fishrc file

Add mamba to Fish shell, so you can use mamba activate mamba666 instead of mamba init first

You will get error like:

Run 'mamba init' to be able to run mamba activate/deactivate and start a new shell session. Or use conda to activate/deactivate.

Fish will automatically load your .bashrc file. But you have to add mamba to fish manually.

# add the following to ~/.config/fish/config.fish
# Adapted from `function conda` printed by `conda shell.fish hook`, following
# `mamba.sh`.
function mamba --inherit-variable CONDA_EXE
  if [ (count $argv) -lt 1 ]
    $CONDA_EXE
  else
    set -l mamba_exe (dirname $CONDA_EXE)/mamba
    set -l cmd $argv[1]
    set -e argv[1]
    switch $cmd
      case activate deactivate
        eval ($CONDA_EXE shell.fish $cmd $argv)
      case install update upgrade remove uninstall
        $mamba_exe $cmd $argv
        and eval ($CONDA_EXE shell.fish reactivate)
      case '*'
        $mamba_exe $cmd $argv
    end
  end
end 
mamba init fish
# This will add lines to your fish rc file

Now you can do:

mamba activate mamba666
# Backup your rc file
cp ~/.config/fish/config.fish ~/.config/fish/config.fish.bk

The idea is to give mamba the power to do mamba activate like conda activate.

Install Oh-my-fish shell on a remote cluster that you can not sudo

Oh My Fish provides core infrastructure to allow you to install packages which extend or modify the look of your shell. It's fast, extensible and easy to use.

curl https://raw.githubusercontent.com/oh-my-fish/oh-my-fish/master/bin/install > install
fish install --path=~/.local/share/omf --config=~/.config/omf
# Install aborted: Git version 1.9.5 or greater required; you have 1.8.3.1
mamba activate mamba666 # We have the new git here.

fish install --path=~/.local/share/omf --config=~/.config/omf
# It will succeed this time.

Install fish LOGO function by oh-my-fish

omf install fish_logo

# Add this to your fish greeting with this function:
function fish_greeting
    fish_logo
end

# Just write it to ~/.config/fish/functions/fish_greeting.fish
# You will see it every time you start a new session.
Install Oh-My-Fish theme
# All your available theme
omf theme
omf install bobthefish

Uninstall Oh-My-Fish

ma # Go to mamba666 env with higher git version
omf destroy

Install Starship presets

starship preset pastel-powerline > ~/.config/starship.toml

Set environmental variable in Fish

set -U fish_user_paths /opt/homebrew/bin $fish_user_paths

A more efficient way to produce commandline and submit jobs in quest (fish shell)

This is a useful script from Tingyou Wang.

# n means the number of command you want to divide
divide -i cmd_list_332 -n 4 
sub # Write by myself

Use Fish shell to do loop

The fish shell language is more clean and comfortable.

for dir in (ls -d SRR11563614 SRR11563615 SRR11563616)
    set source_dir "$dir/$dir"
    set target_dir "$dir"
    mv "$source_dir"/*.sra "$target_dir"
    rip "$source_dir"
end

Install Fisher and install functions

A plugin manager for Fish—the friendly interactive shell.

curl -sL https://git.io/fisher | source && fisher install jorgebucaran/fisher

# Install functions
fisher install laughedelic/fish_logo

Setting vscode as the default editor for text files in Mac Finder

brew install duti

# To set all text files and code files to vscode instead of xcode use this set of shell commands.

duti -s com.microsoft.VSCode public.json all
duti -s com.microsoft.VSCode public.plain-text all
duti -s com.microsoft.VSCode public.python-script all
duti -s com.microsoft.VSCode public.shell-script all
duti -s com.microsoft.VSCode public.source-code all
duti -s com.microsoft.VSCode public.text all
duti -s com.microsoft.VSCode public.unix-executable all
# this works for files without a filename extension
duti -s com.microsoft.VSCode public.data all

duti -s com.microsoft.VSCode .c all
duti -s com.microsoft.VSCode .cpp all
duti -s com.microsoft.VSCode .cs all
duti -s com.microsoft.VSCode .css all
duti -s com.microsoft.VSCode .go all
duti -s com.microsoft.VSCode .java all
duti -s com.microsoft.VSCode .js all
duti -s com.microsoft.VSCode .sass all
duti -s com.microsoft.VSCode .scss all
duti -s com.microsoft.VSCode .less all
duti -s com.microsoft.VSCode .vue all
duti -s com.microsoft.VSCode .cfg all
duti -s com.microsoft.VSCode .json all
duti -s com.microsoft.VSCode .jsx all
duti -s com.microsoft.VSCode .log all
duti -s com.microsoft.VSCode .lua all
duti -s com.microsoft.VSCode .md all
duti -s com.microsoft.VSCode .php all
duti -s com.microsoft.VSCode .pl all
duti -s com.microsoft.VSCode .py all
duti -s com.microsoft.VSCode .rb all
duti -s com.microsoft.VSCode .ts all
duti -s com.microsoft.VSCode .tsx all
duti -s com.microsoft.VSCode .txt all
duti -s com.microsoft.VSCode .conf all
duti -s com.microsoft.VSCode .yaml all
duti -s com.microsoft.VSCode .yml all
duti -s com.microsoft.VSCode .toml all

Save the ~/.config file to save your shell configuration

# You can save this whole directory, make your transfer and installation easier
/home/qgn1237/.config

Useful fish command collection - autopair.fish

# autopair.fish, auto-complete matching pairs in the Fish command line. Type pair () for you.
fisher install jorgebucaran/autopair.fish

Useful fish command collection - z.fish

z tracks the directories you visit. With a combination of frequency and recency,
it enables you to jump to the directory in mind.

# Install
fisher install jethrokuan/z
z foo: Goes to directory best matching foo.
zo foo: Opens file manager of directory best matching foo.
z -t foo: Goes to most recent directory matching foo.
z -x: Removes the current directory from $Z_DATA.

Calculate the allele frequency from the AD and SAC info field in a structural variants vcf file

chr1 10837 svim.INS.4 N 8 PASS SVTYPE=INS;END=10837;SVLEN=79;SUPPORT=7;STD_SPAN=5.8;STD_POS=40.06 GT:DP:AD 0/1:30:23,7

It is possible to calculate the allele frequency from the AD info in this specific structural variants VCF file. The AD field lists the depth of coverage for each allele at a particular variant site, in this case, the AD field has two values separated by a comma (23, 7). To calculate the frequency, you can divide the number of reads supporting the alternate allele (7) by the total number of reads (23 + 7 = 30). So the allele frequency would be 7/30 = 0.23 or 23%.

DP4 is another form of SVC

DP4=0,0,14,12;

DP4 reports the number of reads covering the position with the reference allele mapped to forward and reverse strands, followed by alternate allele mapped to forward and reverse strands.

Allele frequency here would be 0 (0/26) for reference allele, and 1.0 (26/26) for alternate allele.

xcrun: error: invalid active developer path (/Library/Developer/CommandLineTools), missing xcrun at: /Library/Developer/CommandLineTools/usr/bin/xcrun, you can't use your git after upgrading macOS

xcode-select --install

This will pop a dialogue box, Select "Install", and it will download and install the Command Line Tools package and fix the problem.

Update Yang lab Library

Edit the library.yaml file first, add the book name and STAR

Then

make cover
git add ..
git commit -n "n"
git push origin main

Configure your NeoVim

Neovim (and many other applications) doesn't touch your ~/.config/ directory per default. You just need to create the nvim directory

It's different from Vim, you need to:

mkdir -p ~/.config/nvim

nvim ~/.config/nvim/init.vim # Edit it

# For example, add: set mouse=v

Can't Copy to Clipboard from neovim, what's wrong?

Becasue nvim sets your vim into visual mode whenever you select something with the mouse. And for some mad reason one is not allowed to copy when in visual mode. You can get around it by holding down shift when selecting text not to go into visual mode allowing you to use the copy menu.

Simply edit the ~/.config/nvim/init.vim and add:

set mouse=v

Done!

Github push error: fatal: Unable to create '/Users/qgn1237/Library/CloudStorage/OneDrive-NorthwesternUniversity/github_project/Computational-Medicine-and-Bioinformatics-Terminology-Database/.git/index.lock': File exists

The error message suggests that there is a lock file present, which typically means that another Git process is running or a previous Git process did not exit cleanly. To resolve the issue, follow these steps:

Make sure there are no other active Git processes running. Close any relevant terminal windows or Git applications that might be accessing the repository.

Remove the lock file manually. In your terminal, navigate to the repository's root directory and run the following command:

rm -f .git/index.lock

Extract all the text from a powerpoint file

pip install python-pptx

./extract_text_ppt.py 【20230413】qingxiang_guo_basic_seminar.pptx

# You can find it in the script directory

Filter the structural variants VCF results

  1. Filter the SVIM results
# A SVIM result looks like this:
GL000008.2  1524  svim.DEL.7  AGAATGGGATGGAATGGAATTGAATGATGTGGAGTGGAGTCGGGTGGAGTGGA A 2 PASS  SVTYPE=DEL;END=1576;SVLEN=-52;SUPPORT=2;STD_SPAN=4.24;STD_POS=14.85 GT:DP:AD  ./.:.:.,.

# Filtering the variant calls by QUAL, supporting reads, and PASS, we cannot make a general statement about suitable score cutoffs. # For high-coverage datasets (>40x), we would recommend a threshold of 10-15. For low-coverage datasets, the threshold should be lower.

# A good approach could also be to select a cutoff that returns the expected or desired number of calls. A recent study by the Human Genome Structural Variation Consortium (HGSVC), for instance, estimated the average number of deletions and insertions per individual to be 9,488 and 15,337, respectively (Chaisson et al., 2019)

bcftools filter -i 'QUAL >= 5 && FILTER == "PASS" && INFO/SUPPORT >= 2' input.vcf > output.vcf

This is a strict criteria that can filter 400,000 SVs to 2,000

So you should make trial & error
  1. Filter the PBSV results
chr1    669597  pbsv.INS.DUP.0  A       <DUP>   .       PASS    SVTYPE=DUP;END=669679;SVLEN=82  GT:AD:DP:SAC    1/1:1,4:5:1,0,3,1
# PBSV will not have the SUPPORT reads option

bcftools filter -i 'FILTER == "PASS" && FORMAT/AD[0:1] >= 2' input.vcf > output.vcf
# When filtering SVs, the variants with high support can be filtered based on the threshold value of AD [1].
# The [0:1] means the 1 subfield of the 0 sample
  1. Filter the Sniffles2 results
# Sniffles has already an automatic filter in the output.
# If you want to filter further, the easiest is to ignore the IMPRECISE marked calls 
# Another thing would be to filter for the number of read supports

chr1    710590  Sniffles2.INS.14S0      N       AAGAACTGCCTGCCGGGCGCGTGTGGCTCACGCCTTGTAATTCCCAGCACTTTGGGAGGCCGCAGGCGGGCCGGATCACGAGCGTCAGGAGATCGAGACCATCCCGGCTAAAACGGCTTTGAAAAAACCCCGTCTCTACTAAAAATTACAAAAAATTAGCCCCGTAGTGGCGGGCGCGTTTAGTCCCAGCTACTTTGCGGAGGCTGAGGCAGGAAGAATGGGCGTGAACCCGCGGAGGTGGAGCTTTGCAGTGAGCCTAAGATCCCACTCACTCCAGCCTGCGGCGACAGAGCCAGACTCGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA   31      PASS    PRECISE;SVTYPE=INS;SVLEN=333;END=710590;SUPPORT=3;COVERAGE=2,3,3,3,3;STRAND=+-;AF=1.000;STDEV_LEN=18.502;STDEV_POS=6.083;SUPPORT_LONG=0 GT:GQ:DR:DV     1/1:8:0:3

# DV:Depth of variant-supporting bases

bcftools view -i 'INFO/SUPPORT >= 2 && INFO/IMPRECISE != 1' intput.vcf > output.vcf
  1. Filter the CuteSV results
chrY 56833655 cuteSV.DEL.48873 TCCTATTCCATTCCTC T . PASS PRECISE;SVTYPE=DEL;SVLEN=-15;END=56833670;CIPOS=-1,1;CILEN=-0,0;RE=3;RNAMES=NULL;STRAND=+- GT:DR:DV:PL:GQ ./.:.:3:.,.,.:.

bcftools view -i 'FILTER == "PASS" && INFO/PRECISE == 1 && INFO/RE >= 2' input.vcf > output.vcf
  1. Filter the DeBreak results
chrY 2464326 DB4000 TTCCCTAGCAATCCGGCCAAGGGCCGCTGATGTGCACACACTGAAGACGTTCCCTAAGTGTGTGGCTAAGGGACTGCTACCATATACACACTGAAGATGTTCCCTAAGAATGTGGGTAAGGGACCGCCGCCATGTTCGCACTGAAGACG N . PASS CHR2=chrY;SVLEN=149;SUPPREAD=4;MAPQ=0;SVMETHOD=DeBreak;PRECISE;SVTYPE=DEL GT 0/1

bcftools view -i 'FILTER == "PASS" && INFO/PRECISE == 1 && INFO/SUPPREAD >= 2' input.vcf > output.vcf
  1. Filter the SVDSS results
chrX 147512934 DEL_chrX:147512934-147512961_28 TTGCAGTACAATACACATTGTATTACAC T . PASS VARTYPE=SV;SVTYPE=DEL;SVLEN=-28;END=147512961;WEIGHT=2;COV=4;AS=358;NV=1;CIGAR=33=28D46= GT 0/1

# You can filter the reported SVs by passing the --min-sv-length and --min-cluster-weight options. These options control the minimum length and minimum number of supporting superstrings for the reported SVs. Higher values for --min-cluster-weight will increase precision at the cost of reducing recall. For a diploid 30x coverage sample, --min-cluster-weight 2 produced the best results in our experiments. For a haploid 30x sample, instead, --min-cluster-weight 4 produced the best results.

bcftools view -i 'FILTER == "PASS" && INFO/NV >= 2' input.vcf > output.vcf

Convert BED to VCF coordinate

If BED start and end = 0 8, VCF start =1, end = 8 BED is 0-based coordinate system, VCF is 1-based

Filter a VCF file based on the SVLEN field

filter_vcf_based_on_length.py -i input.vcf -o length.vcf -l 50

How to Restore the MK1C Device from an Update Error

This guide aims to assist users facing a specific issue with the MinION Mk1C device. Users may experience problems after attempting to update the device's software version, causing the device to blackout, display a blue screen with various icons, or show an "Unknown" installed version.

Symptoms:

  1. After clicking on "Install Update" for a software version upgrade, the device blacks out for an extended period (e.g., over 16 hours).
  2. The device occasionally displays a blue screen with various icons, including menu icons, a mail icon, and the test flow cell icon. Despite prompts to swipe up to unlock, the device remains on the blue screen.
  3. After rebooting, the interface changes and the "MinKNOW Installed version" now shows "Unknown".
  4. In the Host Settings, the Network Settings option is missing, preventing the user from confirming the network connection status or obtaining the device's IP address.
  5. When attempting to run the “ssh minit@mc-XXXX” command, the system reports an error: “ssh: Could not resolve hostname mc-XXXX: nodename nor servname provided, or not known”.
  6. Attempting to restore using a previous SD card (with an earlier software version) does not resolve the issue.

Resolution:

Step 1: Preparing a USB drive

  1. Format a USB key as FAT or exFAT.
  2. Create a directory on the USB called minit_config.
  3. In the minit_config directory, create two plain files (without file extensions): ssh and access-point. These are command files that will enable SSH and put the device into hotspot mode.

Step 2: Enabling SSH and hotspot mode on the device

  1. Plug the USB drive into the powered-on Mk1C device. The white LEDs on the screen should stop scrolling and all flash red twice, indicating the script's activation.
  2. The device will execute the commands in the minit_config folder and capture some system configuration information. Once complete, the lights will flash green, indicating the process is complete and the drive can be safely removed.

Step 3: Connecting to the device

  1. Reboot the device.
  2. Connect to the device's hotspot using another device (e.g., a computer). The hotspot should have the same name as the Mk1C device (e.g., MC-1XXXX). The password is: WarmButterflyWings98

Step 4: Accessing the device via SSH

  1. SSH into the device using the following command: ssh minit@10.42.0.1 Note: If you have connected with other Mk1c deivce before, clean the key by :

ssh-keygen -R 10.42.0.1 and ssh again.

  1. Run the following command to get the device's IP address while connected to Ethernet: ifconfig. The IP address is listed for eth0.

Step 5: Updating the device

If the device has an internet connection, run the following commands to update it:

sudo apt clean
sudo apt --fix-broken install
sudo shutdown -r now

Note:

This guide is based on a specific issue and might not apply to all problems encountered with the MinION Mk1C device. For different issues, please contact the Nanopore official technical support or check the Nanopore community forums for assistance.

How to Update the MinION Mk1C Software via SSH

While the MinION Mk1C software can generally be updated via the user interface, some scenarios require manual software updates. If you prefer to update through the command line or need feedback during updates, this guide is for you.

Please always refer to the release notes for any version-specific commands that may be supplied.

Prerequisites:

  1. Ensure that the MinION Mk1C is connected to a stable internet connection.
  2. Have SSH access to the MinION Mk1C.

Steps to Update Only the MinKNOW Software:

  1. Connect to the MinION Mk1C using SSH.
  2. Open a terminal window.
  3. Run the following commands one at a time to update the list of available software:
sudo apt autoclean
sudo apt clean
sudo apt autoremove
sudo apt-key adv --fetch-keys https://cdn.oxfordnanoportal.com/apt/ont-repo.pub
sudo apt update
sudo apt install ont-mk1c-release

These commands should complete successfully, without any errors or warnings.

  1. If you encounter any error or warning message, ensure that your MinION Mk1C is connected to the Internet. You can diagnose network connection problems by running the following command:
sudo apt --fix-broken install
sudo apt update
sudo apt install ont-mk1c-release
  1. Once the commands have completed successfully without errors, reboot the device using the command:
sudo reboot

Steps to Update the Operating System and MinKNOW Software Simultaneously:

If you want to update both the operating system and MinKNOW software at the same time, follow these steps:

  1. Connect to the MinION Mk1C using SSH.
  2. Open a terminal window.
  3. Run the following commands one at a time:
export DEBIAN_FRONTEND=noninteractive 
sudo apt upgrade
  1. Reboot the device using the command:
sudo reboot

Note: This will update all packages to their latest versions, so it may take longer than the MinKNOW-only update.

Remember to check the 'Current version' under software version number after the updates to ensure that your software has been updated successfully.

Install LunarVim in Fish Shell

Prerequisites

Before starting, ensure that you have the following installed:

  • Latest version of Neovim (v0.9.0+)
  • Git
  • Make
  • Pip
  • Python
  • NPM
  • Node.js
  • Cargo

Installation Steps

  1. Enter your mamba environment:

    ma
  2. Execute the LunarVim installation script using bash:

    env LV_BRANCH='release-1.3/neovim-0.9' bash -c "bash <(curl -s https://raw.githubusercontent.com/LunarVim/LunarVim/release-1.3/neovim-0.9/utils/installer/install.sh)"

    During this step, you may encounter an error related to the compilation of nvim-treesitter[python]. This occurs when the cc1plus compiler is not found.

    if you are neovim with > 10 version,use:

    bash <(curl -s https://raw.githubusercontent.com/lunarvim/lunarvim/master/utils/installer/install.sh) 
  3. To resolve this issue, you can install a C++ compiler within your Mamba environment using the following command:

    mamba install -c conda-forge cxx-compiler
  4. Afterwards, set the CXX environment variable to point to your environment's g++:

    export CXX=$CONDA_PREFIX/bin/g++
set -U fish_user_paths $fish_user_paths ~/.local/bin/ .  # Set the environmental variable
make sure to manually run ':Lazy sync' when starting lvim for the first time.

Installing Plugins in LunarVim

This guide shows how to install and use the Dracula theme in LunarVim. Similar steps can be followed for other plugins.

Step 1: Open the LunarVim Configuration File

First, you need to open your LunarVim configuration file. You can do this with the following command:

nvim ~/.config/lvim/config.lua

Step 2: Add the Plugin Information

In the configuration file, locate the lvim.plugins section. Here you add the plugin information. For example, to add the Dracula theme, you can use:

lvim.plugins = {
    {
        "Mofiqul/dracula.nvim",
    },
    -- more plugins can go here
}

Step 3: Set the Theme

Next, set your chosen theme. For Dracula, you can use:

lvim.colorscheme = "dracula"

Step 4: Save and Exit

Save and exit the file.

Install and using Zellij to manage terminal windows

cargo install --locked zellij

zellij setup --dump-config > ~/.config/zellij/config.kdl # Create config file

zellij options --theme dracula # change theme

ctrl + O and d to leave the session, zellij a to attach a session, zellij -s to create a new session

zellij action close-pane # Close the current pane.

Accelerating Your Command Line Operations using Zellij and SLURM (original by yangyang Li, https://yangyangli.top/)

This tutorial will guide you through the steps to expedite your command line operations on a compute node from a login node, using zellij to maintain an interactive srun session in a SLURM-managed cluster. This process can greatly improve your command execution speed, especially if your login node is heavily loaded.

Prerequisites

  • Basic understanding of command line interface (CLI)
  • Access to a SLURM-managed cluster
  • zellij and srun command line tools installed

Steps

Step 1: Start a Zellij Session

To begin, open your command line interface and start a new Zellij session by typing:

zellij -s q

The -s q option gives a name (in this case, "q") to your Zellij session.

Step 2: Check Your Current Node

You can verify the node you're currently on by executing the hostname command:

hostname

This command will return the name of the node you're currently logged into. At this point, you should be on the login node.

Step 3: Start an Interactive Srun Session

Next, you can start an interactive srun session with specified resources. This command will move you from the login node to a compute node, enhancing your command execution speed:

srun -n 12 -p b1171 --account=b1171 -t 10:00:00 --mem 16g --pty bash

In this example, -n 12 specifies the number of CPUs, -p b1171 specifies the partition, --account=b1171 specifies the account, -t 10:00:00 specifies the time limit, and --mem 16g specifies the amount of memory.

Step 4: Verify the Compute Node

Once the srun session starts, you can verify that you're on a compute node by running the hostname command again.

Step 5: Exit the Zellij Session

When you're done with your tasks on the compute node, you can detach from the Zellij session without ending the srun session by using the shortcut Ctrl + o, followed by d.

Conclusion

This tutorial walked you through the process of using Zellij and srun to expedite your command line operations on a compute node. Remember, when you exit Zellij, any tasks running within the srun session will continue to run until they're completed or until the time limit is reached. Thus, you can significantly improve your productivity by leveraging the computational power of the compute nodes.

Of course! Here's a markdown-formatted guide to solve the problem you described:


Solving Name Resolution Issue in Windows WSL Ubuntu

If you're experiencing issues with SSH and name resolution within the Windows Subsystem for Linux (WSL) Ubuntu system, the following steps can help you address it.

Symptoms

  • Failed SSH attempts due to "failure in name resolution."
  • Using ping results in an error, e.g., ping: quest.northwestern.edu temporary failure in name resolution.
  • Accessing websites via a browser on Windows works without issues.

Solution

1. Configuring WSL to Stop Automatically Generating resolv.conf

WSL can automatically generate the resolv.conf file, which may cause DNS resolution problems. To prevent WSL from auto-generating this file:

  1. Open WSL terminal.
  2. Create or edit the wsl.conf file by typing:
    sudo vim /etc/wsl.conf
    
  3. Add the following content to the file:
    [network]
    generateResolvConf = false
    
  4. Save the file and exit.

2. Manually Setting Up DNS Configuration

You'll need to manually set up the DNS configuration in the resolv.conf file:

  1. Still within the WSL terminal, create a new resolv.conf file:

    sudo vim /etc/resolv.conf
    
  2. Add the following content:

   # This file was automatically generated by WSL. To stop automatic generation of this file, 
   # add the following entry to /etc/wsl.conf:
   # [network]
   # generateResolvConf = false
   # nameserver 172.23.0.1
   nameserver 8.8.8.8
  1. Save the file and exit.

3. Test the Solution

After performing the above steps, test the solution:

  1. In the WSL terminal, try pinging a known website:
    ping google.com
    

Precision-Recall Diagrams using precision-recall-diagrams.py

This guide provides a quick walkthrough on how to visualize the trade-off between precision and recall using the provided Python script.

How to Use

  1. Prepare Your Data:

    The script uses predefined data. If you want to use your own data, modify the prs array inside the script:

    prs = np.array([
        [precision1, recall1],
        [precision2, recall2],
        ...
    ])
    labels = ["Label 1", "Label 2", ...]
  2. Run the Script:

    Navigate to the script's directory and execute:

    python precision-recall-diagrams.py

Understanding Poetry and Pip in Python Package Management**

Poetry vs. Pip in Python

Pip Install

  • Tool: Standard package installer for Python.
  • Use Case: Used by end-users for installing Python packages from PyPI or other sources.
  • Focus: Manages the installation of individual packages without handling project-wide dependencies.

Poetry Install

  • Tool: Modern Python dependency management and packaging tool.
  • Use Case: Suited for developers managing dependencies of entire projects.
  • Functionality: Installs all dependencies based on pyproject.toml and may create virtual environments for isolation.
  • Advantages: Manages project dependencies, ensuring consistent development environments.

Command Line Tools Installation

  • Both pip and poetry install command line tools of packages to Scripts (Windows) or bin (Unix-like systems) in the Python environment.
  • These directories are typically included in the system's PATH, allowing command line recognition and execution of these tools.

Entry Points

  • Mechanism: Allows packages to specify one or more command line script entry points.
  • Implementation: Scripts created during package installation, placed in executable directories.
  • Configuration:
    • setup.py for pip: entry_points={'console_scripts': ['mycommand = mypackage.mymodule:main_func']}
    • pyproject.toml for poetry: [tool.poetry.scripts] mycommand = 'mypackage.mymodule:main_func'
  • Function: These scripts are lightweight wrappers calling functions or classes in the package.

Summary

  • poetry install enhances Python's environment by managing and installing a project's packages and dependencies, updating module paths (sys.path), and setting up command line tools. This process ensures that packages and their dependencies are accessible and functional in the specified Python environment.

Understanding Poetry, Python Environment, and Entry Points

Poetry Installation Process

  • Dependency Resolution: Reads pyproject.toml to determine required packages and versions.
  • Virtual Environment: Installs packages in the active or a new virtual environment.
  • Package Installation: Downloads and installs packages from PyPI or other sources into the Python environment.
  • Module Path Update: Adds installed packages' paths to Python's sys.path.
  • Entry Point Setup: Creates scripts for command line tools as defined in pyproject.toml.
  • Dependency Locking: Updates poetry.lock to ensure consistent versions across environments.

Python Environment

  • Python Path (sys.path): A list where Python looks for modules to import.
  • Site-packages Directory: Common location for installed packages (e.g., /Users/qgn1237/mambaforge/envs/test_octopusv/lib/python3.9/site-packages).

Entry Points and Package Discovery

  • Executable Scripts: Located in bin or Scripts directory of the Python environment.
  • Example Script Path: /Users/qgn1237/mambaforge/envs/test_octopusv/bin/octopusv.
  • Import Logic in Scripts: Can successfully import modules (e.g., from octopusv.cli.cli import app) due to their presence in the site-packages directory.

Locating Installed Packages

  • octopusv Package: Typically found in the site-packages directory.
  • Metadata Directory (octopusv-0.1.0.dist-info): Contains metadata like direct_url.json, entry_points.txt, INSTALLER, METADATA, and RECORD.

Automated Software Testing with Nox, Pytest, and GitHub Actions

This tutorial explains how to automate your software testing process using Nox, Pytest, and GitHub Actions.

Step 1: Configure Nox

Create a noxfile.py with sessions for different Python versions:

import nox

@nox.session(python="3.9")
def tests_39(session):
    session.run("poetry", "install", external=True)
    session.run("pytest", "--cov", "--cov-report=html")

@nox.session(python="3.10")
def tests_310(session):
    session.run("poetry", "install", external=True)
    session.run("pytest", "--cov", "--cov-report=html")

Step 2: Write Pytest Test Cases

Create a tests folder with your test cases. Here's an example test script:

import subprocess
import filecmp
import pytest
import os

# The test dir
TEST_DATA_DIR = "tests/data/VCF_for_testing_correct"
OUTPUT_DIR = "tests/output"
os.makedirs(OUTPUT_DIR, exist_ok=True)


def run_octopusv(input_file, output_file):
    """
    Run octopusv.
    """
    cmd = f"octopusv correct {input_file} {output_file}"
    subprocess.run(cmd, shell=True, check=True)


def test_mate_bnd_independent():
    input_vcf = os.path.join(TEST_DATA_DIR, "test_mate_bnd_independent.vcf")
    output_vcf = os.path.join(OUTPUT_DIR, "output_mate_bnd_independent.vcf")
    expected_output_vcf = os.path.join(TEST_DATA_DIR, "example_mate_bnd_independent.vcf")

    run_octopusv(input_vcf, output_vcf)

    # Compare output and expected file
    assert filecmp.cmp(output_vcf, expected_output_vcf)

Step 3: Setup GitHub Actions

Create a workflow file in .github/workflows/tests.yml. This file defines the CI pipeline.

name: Tests

on:
  push:
    branches:
      - main
    paths:
      - "**.py"
      - "**/Dockerfile"
      - ".github/workflows/*.yml"
      - poetry.lock
      - pyproject.toml

  pull_request:
    branches:
      - main
    paths:
      - "**.py"
      - "**/Dockerfile"
      - ".github/workflows/*.yml"
      - poetry.lock
      - pyproject.toml

jobs:
  tests:
    name: ${{ matrix.session }} ${{ matrix.python }} / ${{ matrix.os }}
    runs-on: ${{ matrix.os }}
    strategy:
      fail-fast: false
      matrix:
        include:
          - { python: "3.10", os: "ubuntu-latest", session: "pre-commit" }
          - { python: "3.10", os: "ubuntu-latest", session: "safety" }
          - { python: "3.10", os: "ubuntu-latest", session: "mypy" }
          - { python: "3.9", os: "ubuntu-latest", session: "mypy" }
          - { python: "3.10", os: "ubuntu-latest", session: "tests" }
          - { python: "3.9", os: "ubuntu-latest", session: "tests" }
          - { python: "3.10", os: "macos-latest", session: "tests" }
          - { python: "3.9", os: "macos-latest", session: "tests" }
          - { python: "3.10", os: "ubuntu-latest", session: "docs-build" }

    env:
      NOXSESSION: ${{ matrix.session }}
      FORCE_COLOR: "1"
      PRE_COMMIT_COLOR: "always"

    steps:
      - name: Check out the repository
        uses: actions/checkout@v4
        with:
          fetch-depth: 1

      - name: Cache pip packages
        uses: actions/cache@v3
        with:
          path: ~/.cache/pip
          key: ${{ runner.os }}-pip-${{ matrix.python }}-${{ hashFiles('**/requirements.txt') }}
          restore-keys: |
            ${{ runner.os }}-pip-${{ matrix.python }}-
            ${{ runner.os }}-pip-

      - name: Cache Poetry virtual environment
        uses: actions/cache@v3
        with:
          path: .venv
          key: ${{ runner.os }}-poetry-${{ matrix.python }}-${{ hashFiles('pyproject.toml') }}
          restore-keys: |
            ${{ runner.os }}-poetry-${{ matrix.python }}-
            ${{ runner.os }}-poetry-

      - name: Set up Python ${{ matrix.python }}
        uses: actions/setup-python@v4
        with:
          python-version: ${{ matrix.python }}

      - name: Upgrade pip
        run: |
          pip install --constraint=.github/workflows/constraints.txt pip
          pip --version

      - name: Upgrade pip in virtual environments
        shell: python
        run: |
          import os
          import pip

          with open(os.environ["GITHUB_ENV"], mode="a") as io:
              print(f"VIRTUALENV_PIP={pip.__version__}", file=io)

      - name: Install Dependencies
        if: matrix.os == 'ubuntu-latest'
        run: |
          sudo apt-get update
          sudo apt-get install -q --no-install-recommends --no-install-suggests libhts-dev  libssl-dev

      - name: Cache macOS dependencies
        if: matrix.os == 'macos-latest'
        uses: actions/cache@v3
        with:
          path: ~/brew-cache
          key: macos-brew-${{ hashFiles('**/Dockerfile') }}
          restore-keys: |
            macos-brew-

      - name: Configure Homebrew
        if: matrix.os == 'macos-latest'
        uses: Homebrew/actions/setup-homebrew@master

      - name: Install Dependencies
        if: matrix.os == 'macos-latest'
        env:
          HOMEBREW_NO_AUTO_UPDATE: 1
          HOMEBREW_NO_INSTALL_CLEANUP: 1 # Do not run brew cleanup automatically.
          HOMEBREW_NO_INSTALLED_DEPENDENTS_CHECK: 1 # Do not automatically update packages.

        run: |
          brew install htslib
          brew install openssl@3
          ln -sf  $(brew --prefix openssl)/include/openssl /usr/local/include/openssl
          ln -sf  $(brew --prefix openssl)/lib/*a /usr/local/lib/
          ln -sf  $(brew --prefix openssl)/lib/*dylib /usr/local/lib/

      - name: Install Poetry
        run: |
          pipx install --pip-args=--constraint=.github/workflows/constraints.txt poetry
          poetry --version

      - name: debug
        if: matrix.os == 'macos-latest'
        run: |
          which python

      - name: Install Nox
        run: |
          pipx install --pip-args=--constraint=.github/workflows/constraints.txt nox
          pipx inject --pip-args=--constraint=.github/workflows/constraints.txt nox nox-poetry
          nox --version

      - name: Compute pre-commit cache key
        if: matrix.session == 'pre-commit'
        id: pre-commit-cache
        shell: python
        run: |
          import hashlib
          import sys

          python = "py{}.{}".format(*sys.version_info[:2])
          payload = sys.version.encode() + sys.executable.encode()
          digest = hashlib.sha256(payload).hexdigest()
          result = "${{ runner.os }}-{}-{}-pre-commit".format(python, digest[:8])

          print("::set-output name=result::{}".format(result))

      - name: Restore pre-commit cache
        uses: actions/cache@v3
        if: matrix.session == 'pre-commit'
        with:
          path: ~/.cache/pre-commit
          key: ${{ steps.pre-commit-cache.outputs.result }}-${{ hashFiles('.pre-commit-config.yaml') }}
          restore-keys: |
            ${{ steps.pre-commit-cache.outputs.result }}-

      - name: Run Nox for Python 3.9 tests session
        if: matrix.session == 'tests' && matrix.python == '3.9'
        run: nox --session tests_39 --force-color

      - name: Run Nox for Python 3.10 tests session
        if: matrix.session == 'tests' && matrix.python == '3.10'
        run: nox --session tests_310 --force-color

      - name: Upload coverage data
        if: always() && matrix.session == 'tests'
        uses: "actions/upload-artifact@v3"
        with:
          name: coverage-data-${{ matrix.python }}-${{ matrix.os }}
          path: "htmlcov/index.html"

      - name: Upload documentation
        if: matrix.session == 'docs-build'
        uses: actions/upload-artifact@v3
        with:
          name: docs
          path: docs/_build

How It Works

  1. Triggering GitHub Actions:

    • Defined in .github/workflows/tests.yml.
    • Triggered on push or pull request to the main branch.
    • Monitors changes in Python files, Dockerfiles, workflow files, and dependency lock files.
  2. Running Nox Sessions via GitHub Actions:

    • GitHub Actions uses the nox command, as specified in noxfile.py.
    • Runs different Python versions (3.9, 3.10) using separate Nox sessions (tests_39, tests_310).
  3. Nox Session Execution:

    • Installs dependencies via poetry.
    • Executes Pytest with coverage options: session.run("pytest", "--cov", "--cov-report=html").
  4. Pytest Testing Process:

    • Located in the /tests directory.
    • Test scripts like test_correct_end_to_end.py are run.
    • Tests compare the output of octopusv commands with expected results using filecmp.cmp.
  5. Coverage Report Generation and Upload:

    • Pytest generates an HTML coverage report.
    • GitHub Actions uploads this report as an artifact for review.

This setup forms a comprehensive CI/CD pipeline, ensuring that each code change is automatically tested for reliability and coverage.

Absolutely, your understanding is correct. Here's a simple Markdown tutorial in English to guide you through the process of working with Overleaf and GitHub without direct integration:

Working with Overleaf and GitHub

This guide will help you maintain a LaTeX project on Overleaf and synchronize it with a GitHub repository.

Initial Setup

  • Create a repository on GitHub for your LaTeX project.
  • Clone the repository to your local machine using git clone <repository-url>.
  • Create your LaTeX project on Overleaf and begin your writing.

Regular Workflow

Editing on Overleaf

  1. Edit your document on Overleaf as usual.
  2. Download the project from Overleaf by clicking on Menu and selecting Source under Download.

Synchronizing with GitHub

  1. Extract the downloaded ZIP file to your local repository folder.
  2. Open your terminal or command prompt and navigate to your repository folder.
  3. Run the following commands to update your GitHub repository:
    git status                  # Check the changed files
    git add .                   # Add all changes to git
    git commit -m "Description of the changes" # Commit changes
    git push                    # Push changes to GitHub

Continuing Work

  1. Before you start a new session, pull the latest version from GitHub:
    git pull                    # Update your local repository
  2. Upload the updated files to Overleaf:
    • Go to your Overleaf project.
    • Click on Menu and under Upload select ZIP to upload your local repository files.

Collaboration

  • Inform your collaborators to pull from GitHub before they start editing.
  • After they have made changes, they should also push their updates to GitHub.
  • Always communicate with your team when you push or pull changes to avoid conflicts.

Best Practices

  • Commit frequently with clear, descriptive messages.
  • Pull from GitHub before you start working to get the latest version.
  • Push to GitHub after each significant change or at the end of your working session.
  • Use .gitignore to exclude files that don't need to be version controlled (e.g., .aux, .log files).

By following these steps, you can ensure that your LaTeX project is well-maintained and up-to-date across both Overleaf and GitHub.

Remember to replace <repository-url> with the actual URL of your GitHub repository. This guide assumes a basic knowledge of git commands and the functionality of Overleaf. If you or your collaborators are not familiar with git, you may need a more detailed tutorial on git usage.

How to make sure the two files are the same

cmp --silent sim.srt.bam visor.ba || echo "files are different"

Understanding the NODES(A/I/O/T) Column in sinfo --summarize, check nodes availability in SLURM

The NODES(A/I/O/T) column in the output of the sinfo --summarize command provides a quick summary of the state of the nodes in each partition of a Slurm-managed cluster. Here's what each component of this column represents:

  • A (Active nodes): The number of nodes that are currently running jobs. These nodes are fully occupied and are executing tasks.

  • I (Idle nodes): The number of nodes that are idle and available to accept new jobs. These nodes are ready to be utilized but are not currently in use.

  • O (Offline nodes): The number of nodes that are offline or otherwise unavailable. These nodes might be down for maintenance or temporarily out of service.

  • T (Total nodes): The total number of nodes in the partition. This is the sum of active, idle, and offline nodes.

Example Interpretation

If the NODES(A/I/O/T) column shows 25/0/3/28, it means:

  • 25 nodes are currently active and running jobs.
  • 0 nodes are idle and available for new jobs.
  • 3 nodes are offline or unavailable.
  • 28 nodes in total are part of this partition.

VCF Contig and Chromosome Name Corrector Tutorial

When working with VCF files from different sources, chromosome naming inconsistencies can cause issues with tools like bcftools. This Python script helps standardize VCF files by correcting chromosome names and adding proper contig headers based on a reference genome.

The script handles several common issues:

  • Missing contig headers in VCF files
  • Inconsistent chromosome naming (e.g., "1" vs "chr1")
  • Non-standard scaffold names
  • Missing chromosome length information

Key features:

  • Reads chromosome names and lengths from reference FASTA
  • Creates mapping for different chromosome naming conventions
  • Adds or updates contig information in VCF headers
  • Filters out variants on chromosomes not present in reference
  • Maintains VCF format compatibility

Usage example:

python VCF_contig_CHROM_correcter.py input.vcf output.vcf reference.fasta

Common workflow:

# 1. Fix chromosome names and add contig headers
python VCF_contig_CHROM_correcter.py input.vcf corrected.vcf GRCh38.fa

# 2. Sort the corrected VCF
bcftools sort corrected.vcf -o sorted.vcf

# 3. Normalize variants (optional)
bcftools norm -f reference.fa sorted.vcf -o normalized.vcf

# 4. Check the results
bcftools stats normalized.vcf > stats.txt

Tips for usage:

  • Always backup your original VCF files before processing
  • Verify chromosome names in your reference FASTA first
  • Check the output VCF header to ensure contig lines are added correctly
  • Use bcftools stats to validate the output file

Common chromosome naming variations handled:

  • Numerical (1, 2, 3...)
  • Chr-prefixed (chr1, chr2, chr3...)
  • Sex chromosomes (X/chrX, Y/chrY)
  • Mitochondrial (M/MT/chrM)
  • Alternative contigs and scaffolds

The script creates a comprehensive mapping between different chromosome naming conventions and ensures that only variants on chromosomes present in your reference genome are retained. This standardization is particularly important when:

  • Merging VCFs from different sources
  • Running variant callers or analysis tools
  • Comparing variants across datasets
  • Preparing files for submission to databases

Error handling:

  • Invalid VCF format lines are skipped
  • Chromosomes not in reference are excluded
  • Original headers are preserved (except contig lines)

Remember to check your reference genome's chromosome naming convention and adjust the script's mapping if needed for special cases in your data.

ONT Direct RNA004 Pipeline Generator Documentation

This Python script ONT_Direct_RNA004_steps_generator.py generates a SLURM job for analyzing Oxford Nanopore Direct RNA004 sequencing data. The pipeline includes basecalled BAM file conversion, quality filtering, genome alignment, and quality control analysis.

Basic usage:

python ONT_Direct_RNA004_steps_generator.py \
    --bam /path/to/calls.bam \
    --reference /path/to/genome.mmi \
    --sample_name sample1

All available arguments:

--bam           : Input BAM file from Dorado basecalling (required)
--reference     : Reference genome minimap2 index path (required)
--min_quality   : Minimum read quality score (default: 8)
--min_length    : Minimum read length in bp (default: 500)
--threads       : Number of threads (default: 8)
--mem           : Memory allocation (default: 70G)
--time          : Wall time limit (default: 48:00:00)
--sample_name   : Sample name for output files (default: sample)

Example with all parameters:

python ONT_Direct_RNA004_steps_generator.py \
    --bam /projects/data/calls.bam \
    --reference /database/GRCh38.mmi \
    --min_quality 10 \
    --min_length 500 \
    --threads 8 \
    --mem 70G \
    --time 48:00:00 \
    --sample_name PC310cells

The script will generate a SLURM job script named run_ont_rna_[sample_name].slurm that performs:

  • BAM to FASTQ conversion using samtools
  • Read filtering with chopper
  • Genome alignment using minimap2
  • BAM file sorting and indexing
  • Quality control with NanoPlot and Qualimap

To submit the generated SLURM job:

sbatch run_ont_rna_PC310cells.slurm

Output files will include:

  • clean_reads.fastq: Filtered reads
  • [sample_name]_direct_RNA.bam: Aligned reads
  • [sample_name]_direct_RNA.bam.bai: BAM index
  • nanoplot_qc_results/: NanoPlot quality reports
  • qualimap/: Qualimap quality reports

Quick guide for VCF file sort, zip, and indexing

Installation

No additional installation is needed if you have standard bioinformatics tools:

  • awk (built-in with Linux/Unix)
  • bgzip
  • tabix

Usage

./VCF_sort_bgzip_tabix.py -i input.vcf

Input

  • A standard VCF file (uncompressed)

Output

The script will generate three files using the input file's prefix:

  1. {prefix}_sorted.vcf - Sorted VCF file
  2. {prefix}_sorted.vcf.gz - Compressed VCF file
  3. {prefix}_sorted.vcf.gz.tbi - Tabix index file

What it does

The script performs three sequential operations:

  1. Sorts the VCF file while preserving headers
  2. Compresses the sorted file using bgzip
  3. Creates an index using tabix

Example

./VCF_sort_bgzip_tabix.py -i na12878_truth.vcf

This will create:

  • na12878_truth_sorted.vcf
  • na12878_truth_sorted.vcf.gz
  • na12878_truth_sorted.vcf.gz.tbi

VCF Savior tool guide

VCF_savior.py is a comprehensive tool designed to fix common issues in VCF files and make them compatible with truvari for benchmarking structural variants. The tool automatically detects and fixes various problems including header definitions, genotype fields, and chromosome naming conventions.

Basic usage:

python VCF_savior.py -i input.vcf -o output.vcf

For standardizing chromosome names according to reference genome version:

python VCF_savior.py -i input.vcf -o output.vcf -g 38  # for GRCh38 (chr1, chrX format)
python VCF_savior.py -i input.vcf -o output.vcf -g 37  # for GRCh37 (1, X format)

The tool performs the following automatic fixes:

  • Adds missing INFO and FORMAT definitions in the header
  • Standardizes chromosome names for regular chromosomes (1-22, X, Y, M)
  • Fixes genotype (GT) fields and ensures GT is the first FORMAT field
  • Sets all FILTER fields to PASS
  • Fixes SVLEN values based on SVTYPE and END positions
  • Sorts and indexes the output VCF file

Output files:

  • Fixed VCF file (.vcf)
  • Sorted VCF file (_sorted.vcf)
  • Compressed VCF file (_sorted.vcf.gz)
  • Index file (_sorted.vcf.gz.tbi)

The tool is designed to be robust and tolerant of various VCF format issues, making it particularly useful when preparing VCF files for truvari benchmarking.

Promethion SSH Connection Guide

This guide provides instructions for establishing an SSH connection to your Oxford Nanopore Promethion sequencing device.

Prerequisites

  • The Promethion device is powered on and connected to your network
  • You know either the IP address or Device ID of your Promethion
  • You have SSH client software installed on your computer

Connection Steps

  1. Enable Remote Connection on the Promethion

    • On the Promethion touchscreen, navigate to Host Settings > System
    • Find the Remote Connection toggle switch and enable it
  2. Connect via SSH

    • Open a terminal and use one of the following commands:
      ssh prom@192.168.1.xxx  # Using IP Address
      or
      ssh prom@P2-######      # Using Device ID (preferred)
    • Replace P2-###### with your actual Device ID
  3. Enter Password

    • When prompted for a password, enter:
      prom